Gentarget는 유전자 편집 및 생명과학 연구를 위한 고급 솔루션과 서비스를 제공하는 글로벌 생명과학 기업입니다.

About CRE Recombinase:

CRE Recombinase  (click to see its codon sequence), from bacteriophage P1, catalyzes recombination between two LoxP sites (5′- GAAGTTCCTATTCTGTATTTATACGAAGTTAT -3′). Purified CRE enzyme can join individual plasmids containing lox sites.

CRE Expression Lentivirus:

GenTarget provides premade CRE expression lentivirus that can catalyze the joining of lox sites  in vivo. with following features.

1. Those lentivirus contain the nuclear localization signal (NLS), PKKKRKV from the SV40 Large T-antigen at its N-terminus, allowing penetration of the nuclear membrane and thereby increasing the number of in vivo recombination events.
2. CRE is expressed under an optional inducible CMV promoter (TetCMV), or an enhanced EF1a promoter, or a CAG promoter to best fit different cell type.
3. The CRE Expression Lentivirus also a fluorescent or antibiotic selection, or fluorescent-antibiotic fusion dual selection. 
4. Gentarget also provides CRE, luciferase, and fluorescent marker (GFP/RFP) triple-labeled lentivirus.

See the  lentivector structure diagrams below:

Lentivirus are provided as  in two formats:

1. Crude Lentivirus: 200ul /vial in DMEM containing 10 x Polybrene;
2. Concentrated lentivirus: 200ul PBS solution which is better for hard-to-transduced cell types or for serum-free culture.

Note: Ultra-concentrated virus (>= 10⁹ IFU/ml) is available upon special requests.

Please see each Product Manual below for details.

CRE recombinase

Products

Premade Lentivirus

Pathway Reporter

Cell Immortalization

CARs and TCRs

CRISPR Gene Editing

Stable cell lines

Cell-Specific Reporter

Infectious Antigens

Virus Like Particles (VLP)

Non-integrating LV

Adenovirus

shRNA lentivirus

microRNA lentivirus

anti miRNA lentivirus

Lentivectors

Control lentivirus

Ultra titer lentivirus

Eco PCR Cloning Kits

Reagents for Lentivirus

Service

Lentivirus Service

Customized Stable Cell Lines

Fusion In Vivo PCR Cloning

Protein Expression

Antibody Cloning and Expression

GenTarget - Official Distributor in South Korea "Morebio" 한국 공식 대리점 "모아바이오"