YEASEN은 생명과학 연구 및 진단을 위한 고품질의 연구용 시약과 기기를 제공하는 글로벌 바이오 기업입니다.
제품 설명
TelN Protelomerase (5 U/μL)
제품 번호
14540ES72-EN / size: 250 U-EN
14540ES80-EN / size: 1000 U-EN
14540ES90-EN / size: 5000 U-EN
제품 설명
TelN Protelomerase is a recombinant expression from phage N15. It cuts double-stranded DNA (dsDNA) at TelN recognition sequences (56 bp), and generates covalently closed ends at the cleavage sites, which can be applied to enzymatic synthesis of DNA.
Cat.No. | 14540ES72 /14540ES80 / 14540ES90 |
Size | 250U / 1000 U / 5000 U |
Unit Definition | One unit is defined as the amount of enzyme that will convert 0.5 μg of supercoiled plasmid containing telN recognition sites into closed linear dsDNA, in 20 μL reaction system containing 1 X TelN Reaction Buffer at 30℃ for 30 minutes. |
Recognition Sites | TATCAGCACACAATTGCCCATTATACGC↓GCGTATAATGGACTATTGTGTGCTGATA ATAGTCGTGTGTTAACGGGTAATATGCG↑CGCATATTACCTGATAACACACGACTAT |
Heat Inactivation | 75℃ for 5 min |
Components No. | Name | 14540ES72 | 14540ES80 | 14540ES90 |
14540-A | TelN Protelomerase (5 U/μL) | 50 μL | 200 μL | 1 mL |
14540-B | 10 X TelN Reaction Buffer | 250 μL | 1 mL | 5 X 1 mL |
This product should be stored at -25~-15℃ for 1 years.
1. Reaction system preparation
Components | Volume (μL) |
dsDNA (< 300 fmol of TelN sites) | X |
10 X TelN Reaction Buffer | 2 |
TelN Protelomerase (5 U/μL) | 1 |
Nuclease-free water | To 20 |
2. Reaction condition: 30℃ for 30 min after mixing well.
3. Heat inactivation: 75℃ for 5 min.
1. This product is for research use only.
2. Please operate with lab coats and disposable gloves，for your safety.
YEASEN의 모든 제품을 만나 보세요!
YEASEN - Official Distributor in South Korea "Morebio" 한국 공식 대리점 "모아바이오"
MSDS
온라인 견적